Sales contact :  +91 83205 65287

Sales email :  [email protected]

Central University Of Himachal Pradesh Tenders | Latest Tenders of Central University Of Himachal Pradesh

Total 108 tenders found

Tender Bidding Website covers all Tenders of Central University Of Himachal Pradesh – Including Central University Of Himachal Pradesh Government Tenders, e Tender Central University Of Himachal Pradesh, Central University Of Himachal Pradesh Tenders and Private Tenders. There is no shortage of business opportunities from the largest Central University Of Himachal Pradesh Tender Database.

Our website allows you to find Central University Of Himachal Pradesh tenders online quickly and easily. Subscribers can also opt to receive daily tender alerts through email from TenderBidding.com to guarantee they don't miss out on any opportunities.


#TBD : 34442558
0 Days Left
Education And Research Institutes
Himachal Pradesh
Ref. Document
Due on : 16 May, 2025

Gem Bids For Autoclavable Bags , Culture Test Tubes With Autoclavable Caps Without Rim Borosilicate Glass , Conical Flask With Glass Stopper , Glass Tissue Culture Jars With Autoclavable Cap , Extraction Thimbles , Orchid Pots , Muslin Cloth , Test Tube Stand Aluminum , Sample Bags , Capillary Tubes , Crucible With Lid , Hand Made Herbarium Sheets , Herbarium Press , Dissection Box For Botany Practical

View

Bidding

Gem Registration

Download

#TBD : 34278450
0 Days Left
Education And Research Institutes
Himachal Pradesh
Ref. Document
Due on : 16 Apr, 2025

Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Sodium Carbonate 500 G , Thiobarbituric Acid 125 G , Sodium Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Sulfate Feso4 500 G , Sodium Hypochlorite Naocl 500 Ml , Perchloric Acid Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Sodium Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Sodium Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent Glutaraldehyde 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric Acid 1000 Ml , Perchloric Acid 1000 Ml , Glacial Acetic Acid 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric Acid 500 G , Sodium Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric Acid 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey Broth 500 G , Mha Muller Hinton Broth 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 Broth 500 G , Ox Bile Ox Gall 500 G , Mha Agar 500 G , Mrs Broth 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Lactose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient Broth 500 G

View

Bidding

Gem Registration

Download

#TBD : 34527429
0 Days Left
Education And Research Institutes
Himachal Pradesh
Ref. Document
Due on : 02 Jun, 2025

Gem Bids For 1 Dslr Compact Handheld Camcorder Or Video Cameras V2 Q2

View

Bidding

Gem Registration

Download

#TBD : 34678103
0 Days Left
Education And Research Institutes
Himachal Pradesh
90.00 Lacs
Due on : 23 Jun, 2025

Gem Bids For Bus Hiring Service - Regular Basis - Local; 37-39; Non Deluxe Ndx; 150

View

Bidding

Gem Registration

Download

#TBD : 34274211
0 Days Left
Education And Research Institutes
Himachal Pradesh
Ref. Document
Due on : 24 Apr, 2025

Gem Bids For Platinum Coated Silicon Wafer , Titanium Target , Zinc Target , Cobalt Target , Titanium Pellets , Zinc Pellets , Cobalt Pellets , Alumina Ceramic Boat Crucible , Alumina Ceramic Crucible , Thin Films Sample Box , Silver Paste , Fto Substrates , Ito Substrates , Nickel Foam , Carbon Cloth , Quartz Tubes , Kimwipes Disposable Wipers , Silica Gel

View

Bidding

Gem Registration

Download

#TBD : 34353286
0 Days Left
Education And Research Institutes
Himachal Pradesh
Ref. Document
Due on : 10 May, 2025

Gem Bids For Rpmi1640 Medium. Hepes Modifcation With L Glutamine And 25mm Hepes Without Sodium Bicarbonate Powder Suitable For Cell Culture , Fetal Bovine Serum Non-usa Origin Sterile Fltered Suitable For Cell Culture , Ethanol Absolute. For Analysis Emparta Acs , Trypsin From Porcine Pancreas Lyophilized Powder Bioreagent , Thiazolyl Blue Tetrazolium Bromide Powder Bioreagent Suitable For Cell Culture Suitable For Insect Cell Culture , Trypan Blue Solution , Corning Syringe Flters , Lb Broth With Agar , Lb Broth Miller Highlyreferenced Nutrient-rich Microbial Growth Powder Medium Suitable For Regular E Coli Culture , Ethylene Glycol Analytical Standard , Ethylenediaminetetraacetic Acid Acs Reagent , Zinc Acetate , Polyvinylpyrrolidone Mol Wt Number Average Molecular Weight , Gadolinium Iii Nitrate Hexahydrate , Chromium Iii Nitrate Nonahydrate , Cadmium Chloride , N N Dimethylformamide Acs Reagent , I Sodium Citrate Anhydrous Emprove Essential , Ascorbic Acid , Hydrogen Peroxide Solution , Hydrazine Hydrate Solution , Tetra-nbutyl Orthotitanate , Ferric Nitrate Nonahydrate , Magnesium Nitrate Hexahydrate , Samarium Iii Nitrate Hexahydrate , Acetic Acid , Poly Vinyl Alcohol Pva , Samarium Iii Oxide , Niobium V Oxide , Molybdenum Iv Oxide , Samarium Powder For Synthesis , Cobalt Ii Chloride Anhydrous , Nickel Ii Chloride , Lithium Chloride , Hydrofluoric Acid , Silver Nitrate Solution , Ammonium Hydroxide Solution , Silicon Nanoparticles

View

Bidding

Gem Registration

Download

#TBD : 34550860
0 Days Left
Education And Research Institutes
Himachal Pradesh
Ref. Document
Due on : 02 Jun, 2025

Gem Bids For Bus Hiring Service - Regular Basis - Local; 37-39; Non Deluxe Ndx; 150

View

Bidding

Gem Registration

Download

#TBD : 34234694
0 Days Left
Education And Research Institutes
Himachal Pradesh
Ref. Document
Due on : 24 Mar, 2025

Cloud-based Video Conferencing Services 2.0 - 1000; Yes; Yes; 500; All

View

Bidding

Gem Registration

Download

#TBD : 34434662
0 Days Left
Education And Research Institutes
Himachal Pradesh
Ref. Document
Due on : 16 May, 2025

Gem Bids For Zeatin Solution , Murashige And Skoog Medium With Sucrose And Calcium Chloride And Without Agar , Knudson Orchid Medium With Sucrose And Agar With Calcium Chloride , Scopoletin , P-hydroxybenzoic Acid , Linoleic Acid , Pcoumaric Acid , Beta Sitosterol , Sinapic Acid , Piperitone , Pcymene , Ethanol , Streptomycin Solution , Ascorbic Acid , Butylated Hydroxytoluene , Folin-ciocalteu Reagent

View

Bidding

Gem Registration

Download

#TBD : 34542718
0 Days Left
Education And Research Institutes
Himachal Pradesh
Ref. Document
Due on : 03 Jun, 2025

Gem Bids For Bus Hiring Service - Regular Basis - Local; 37-39; Non Deluxe Ndx; 150

View

Bidding

Gem Registration

Download